Skip to main content
Addgene

pSLQ10704
(Plasmid #183957)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 183957 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pHR
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SKSKSO array
  • Alt name
    Poly-crRNA array targeting Sox2, Klf4, Oct4
  • Species
    Synthetic
  • Promoter U6
  • Tag / Fusion Protein
    • EF1a-Puro-T2A-TagBFP (C terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer cgggtttattacagggacagcagag
  • 3′ sequencing primer gagccagtacacgacatcactttc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSLQ10704 was a gift from Stanley Qi (Addgene plasmid # 183957 ; http://n2t.net/addgene:183957 ; RRID:Addgene_183957)
  • For your References section:

    Multiplexed genome regulation in vivo with hyper-efficient Cas12a. Guo LY, Bian J, Davis AE, Liu P, Kempton HR, Zhang X, Chemparathy A, Gu B, Lin X, Rane DA, Xu X, Jamiolkowski RM, Hu Y, Wang S, Qi LS. Nat Cell Biol. 2022 Apr;24(4):590-600. doi: 10.1038/s41556-022-00870-7. Epub 2022 Apr 12. 10.1038/s41556-022-00870-7 PubMed 35414015