pSLQ10873
(Plasmid
#183961)
-
PurposeU6-SKSKSO(crRNA array)-CAG-hyperdCas12a-HA-miniVPR
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 183961 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepUC
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameHyperdCas12a
-
Alt nameLbdCas12a(D156R, E292R, D235R, D350R)
-
Alt nameLbdCfp1(D156R, E292R, D235R, D350R)
-
SpeciesSynthetic
-
MutationD832A, D156R, E292R, D235R, D350R
- Promoter CAG
-
Tag
/ Fusion Protein
- HA (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer GGCAAAGAATTCTGCAGTCGACGGTACC
- 3′ sequencing primer TTTTGGCAGAGGGAAAAAGA (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namepoly-crRNA array targeting Sox2-Klf4-Oct4
-
SpeciesSynthetic
- Promoter U6
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer ACGATACAAGGCTGTTAGAGAG
- 3′ sequencing primer gcggccgcctaatggatccctcgag (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSLQ10873 was a gift from Stanley Qi (Addgene plasmid # 183961 ; http://n2t.net/addgene:183961 ; RRID:Addgene_183961) -
For your References section:
Multiplexed genome regulation in vivo with hyper-efficient Cas12a. Guo LY, Bian J, Davis AE, Liu P, Kempton HR, Zhang X, Chemparathy A, Gu B, Lin X, Rane DA, Xu X, Jamiolkowski RM, Hu Y, Wang S, Qi LS. Nat Cell Biol. 2022 Apr;24(4):590-600. doi: 10.1038/s41556-022-00870-7. Epub 2022 Apr 12. 10.1038/s41556-022-00870-7 PubMed 35414015