crTet in pSLQ8453
(Plasmid
#183965)
-
PurposeU6-crTet-EF1a-Puro-T2A-BFP-WPRE
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 183965 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepHR
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecrTet
-
Alt nameCRISPR RNA (crRNA) targeting TRE3G promoter
-
SpeciesSynthetic
- Promoter U6
-
Tag
/ Fusion Protein
- EF1a-Puro-T2A-BFP (C terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cgggtttattacagggacagcagag
- 3′ sequencing primer gagccagtacacgacatcactttc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For backbone, please refer to Addgene plasmid # 140086 (Backbone for cloning U6 driven LbCpf1 (Cas12a) crRNA, EF1a driven BFP + puromycin resistance)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
crTet in pSLQ8453 was a gift from Stanley Qi (Addgene plasmid # 183965 ; http://n2t.net/addgene:183965 ; RRID:Addgene_183965) -
For your References section:
Multiplexed genome regulation in vivo with hyper-efficient Cas12a. Guo LY, Bian J, Davis AE, Liu P, Kempton HR, Zhang X, Chemparathy A, Gu B, Lin X, Rane DA, Xu X, Jamiolkowski RM, Hu Y, Wang S, Qi LS. Nat Cell Biol. 2022 Apr;24(4):590-600. doi: 10.1038/s41556-022-00870-7. Epub 2022 Apr 12. 10.1038/s41556-022-00870-7 PubMed 35414015