sgDonor_lentiGuide
(Plasmid
#184168)
-
PurposeLentiGuide-puro vector expressing the sgRNA necessary for linearization of the donor cassette plasmid.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 184168 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonelentiGuide-Puro
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgDonor
-
gRNA/shRNA sequenceAAGAGCGAATCGATTTCGTG
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
sgDonor_lentiGuide was a gift from Ophir Shalem (Addgene plasmid # 184168 ; http://n2t.net/addgene:184168 ; RRID:Addgene_184168) -
For your References section:
Efficient and flexible tagging of endogenous genes by homology-independent intron targeting. Serebrenik YV, Sansbury SE, Kumar SS, Henao-Mejia J, Shalem O. Genome Res. 2019 Aug;29(8):1322-1328. doi: 10.1101/gr.246413.118. Epub 2019 Jun 25. 10.1101/gr.246413.118 PubMed 31239279