pAAV-hsyn-DIO-GCaMP6s
(Plasmid
#184284)
-
PurposeExpresses GCaMP6s in genetically defined neurons expressing Cre recombinase
-
Depositing Lab
-
Depositing OrganizationImperial College London
Located in the United Kingdom of Great Britain and Northern Ireland -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 184284 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $34 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepUC
- Backbone size w/o insert (bp) 2900
- Total vector size (bp) 6192
-
Vector typeMammalian Expression, Mouse Targeting, AAV, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCCaMP6s
-
SpeciesSynthetic
-
Insert Size (bp)3400
- Promoter human synaptophysin
-
Tag
/ Fusion Protein
- EGFP
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer ctgactgaagagcagatcgcag
- 3′ sequencing primer ctcactcgagaacgtctatatc
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe GCaMP6s was from Addgene plasmid ID#: 40753, Douglas Kim lab
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hsyn-DIO-GCaMP6s was a gift from William Wisden (Addgene plasmid # 184284 ; http://n2t.net/addgene:184284 ; RRID:Addgene_184284) -
For your References section:
GABA and glutamate neurons in the VTA regulate sleep and wakefulness. Yu X, Li W, Ma Y, Tossell K, Harris JJ, Harding EC, Ba W, Miracca G, Wang D, Li L, Guo J, Chen M, Li Y, Yustos R, Vyssotski AL, Burdakov D, Yang Q, Dong H, Franks NP, Wisden W. Nat Neurosci. 2019 Jan;22(1):106-119. doi: 10.1038/s41593-018-0288-9. Epub 2018 Dec 17. 10.1038/s41593-018-0288-9 PubMed 30559475