pRP[2CRISPR]-mCherry/Hygro-hCas9-U6>{mdx left}-U6>{mdx right}
(Plasmid
#184381)
-
PurposeThis plasmid contains hCas9 and two gRNAs that can excise the genomic area around the mouse mdx mutation in dystrophin's exon 23
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 184381 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonen/a
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCas9, two gRNAs targeting dystrophin
-
gRNA/shRNA sequenceTCTTTGAAAGAGCAATAAAA, ATTTCAGGTAAGCCGAGGTT
-
SpeciesM. musculus (mouse)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer n/a
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Plasmid was generated by VectorBuilder, ID: VB190715-1035jad
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRP[2CRISPR]-mCherry/Hygro-hCas9-U6>{mdx left}-U6>{mdx right} was a gift from Ori Bar-Nur (Addgene plasmid # 184381 ; http://n2t.net/addgene:184381 ; RRID:Addgene_184381) -
For your References section:
CRISPR/Cas9 editing of directly reprogrammed myogenic progenitors restores dystrophin expression in a mouse model of muscular dystrophy. Domenig SA, Bundschuh N, Lenardic A, Ghosh A, Kim I, Qabrati X, D'Hulst G, Bar-Nur O. Stem Cell Reports. 2022 Feb 8;17(2):321-336. doi: 10.1016/j.stemcr.2021.12.003. Epub 2022 Jan 6. 10.1016/j.stemcr.2021.12.003 PubMed 34995499