pLenti_Ef1a:PE2-P2A-GFP
(Plasmid
#184445)
-
Purpose(Empty Backbone) Single EF1a-driven PE2-P2A-GFP (Addgene #132776) and PaqCI restriction sites for pegRNA cloning. Lentiviral backbone and AmpR.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 184445 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLV
-
Backbone manufacturerSignaGen Inc
- Backbone size (bp) 14972
-
Vector typeMammalian Expression, Lentiviral, CRISPR
- Promoter U6 and Ef1A
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer GTGCAGGGGAAAGAATAGTAGACA
- 3′ sequencing primer CGTAGAACCCAGAGATCGCT (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bySignaGen Laboratories
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Backbone was generated by Signagen by cloning PE2-P2A-GFP (Addgene #132776) insert in a pLV backbone. Further addition of PaqCI sites are performed in our lab.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti_Ef1a:PE2-P2A-GFP was a gift from Bobby Koeleman (Addgene plasmid # 184445 ; http://n2t.net/addgene:184445 ; RRID:Addgene_184445) -
For your References section:
Increased prime edit rates in KCNQ2 and SCN1A via single nicking all-in-one plasmids. Dirkx N, Weuring WJ, De Vriendt E, Smal N, van de Vondervoort J, van 't Slot R, Koetsier M, Zonnekein N, De Pooter T, Weckhuysen S, Koeleman BPC. BMC Biol. 2023 Jul 13;21(1):156. doi: 10.1186/s12915-023-01646-7. 10.1186/s12915-023-01646-7 PubMed 37443005