pPL001
(Plasmid
#184750)
-
PurposeBig-IN positive control payload encoding EF1a-driven GFP-T2A-BSD.
-
Depositing Lab
-
Depositing OrganizationNYU Grossman School of Medicine
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 184750 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 184750-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 184750-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepLM1110_LEU2
-
Backbone manufacturerMaurano and Boeke labs, The Center for Synthetic Regulatory Genomics, NYU Langone Health
- Backbone size w/o insert (bp) 9932
- Total vector size (bp) 12551
-
Vector typeMammalian Expression, Mouse Targeting, Cre/Lox, Synthetic Biology ; Recombinase-mediated cassette exchange (RMCE)
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)EPI300
-
Growth instructionsCopy number induction is recommended for high yield preps. See Lucigen’s growth and copy number induction protocol for TransforMax EPI300 cells
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepEF1a-eGFP-T2A-BSD-bGHpA
-
Alt nameHuman EF1a promoter driven CDS containing eGFP, T2A peptide and a blasticidin resistance gene. Bovine Growth Hormone Terminator
-
SpeciesH. sapiens (human), B. taurus (bovine), Synthetic
-
Insert Size (bp)2619
- Promoter EF1a
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TGATCTCGCCCCGAGAACTG
- 3′ sequencing primer TCTATACCCGGGATCCCCAC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 184750-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 184750-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPL001 was a gift from Jef Boeke (Addgene plasmid # 184750 ; http://n2t.net/addgene:184750 ; RRID:Addgene_184750) -
For your References section:
A versatile platform for locus-scale genome rewriting and verification. Brosh R, Laurent JM, Ordonez R, Huang E, Hogan MS, Hitchcock AM, Mitchell LA, Pinglay S, Cadley JA, Luther RD, Truong DM, Boeke JD, Maurano MT. Proc Natl Acad Sci U S A. 2021 Mar 9;118(10). pii: 2023952118. doi: 10.1073/pnas.2023952118. 10.1073/pnas.2023952118 PubMed 33649239