Skip to main content

pPL001
(Plasmid #184750)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 184750 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLM1110_LEU2
  • Backbone manufacturer
    Maurano and Boeke labs, The Center for Synthetic Regulatory Genomics, NYU Langone Health
  • Backbone size w/o insert (bp) 9932
  • Total vector size (bp) 12551
  • Vector type
    Mammalian Expression, Mouse Targeting, Cre/Lox, Synthetic Biology ; Recombinase-mediated cassette exchange (RMCE)
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    TransforMax EPI300
  • Growth instructions
    Copy number induction is recommended for high yield preps. See Lucigen’s growth and copy number induction protocol for TransforMax EPI300 cells
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    pEF1a-eGFP-T2A-BSD-bGHpA
  • Alt name
    Human EF1a promoter driven CDS containing eGFP, T2A peptide and a blasticidin resistance gene. Bovine Growth Hormone Terminator
  • Species
    H. sapiens (human), B. taurus (bovine), Synthetic
  • Insert Size (bp)
    2619
  • Promoter EF1a

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TGATCTCGCCCCGAGAACTG
  • 3′ sequencing primer TCTATACCCGGGATCCCCAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPL001 was a gift from Jef Boeke (Addgene plasmid # 184750 ; http://n2t.net/addgene:184750 ; RRID:Addgene_184750)
  • For your References section:

    A versatile platform for locus-scale genome rewriting and verification. Brosh R, Laurent JM, Ordonez R, Huang E, Hogan MS, Hitchcock AM, Mitchell LA, Pinglay S, Cadley JA, Luther RD, Truong DM, Boeke JD, Maurano MT. Proc Natl Acad Sci U S A. 2021 Mar 9;118(10). pii: 2023952118. doi: 10.1073/pnas.2023952118. 10.1073/pnas.2023952118 PubMed 33649239