Skip to main content

pAAV-OTp-hM3Dq-Myc
(Plasmid #184753)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 184753 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAAV
  • Backbone manufacturer
    n/a
  • Backbone size w/o insert (bp) 2900
  • Total vector size (bp) 7650
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    hM3D (Gq)
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1925
  • Promoter mouse Oxytocin promoter
  • Tag / Fusion Protein
    • 3xMyc (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer TGCTGTCACCCTCTTTAGAC
  • 3′ sequencing primer CCCCCTGAACCTGAAACATA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-OTp-hM3Dq-Myc was a gift from Kazunari Miyamichi (Addgene plasmid # 184753 ; http://n2t.net/addgene:184753 ; RRID:Addgene_184753)
  • For your References section:

    Plasticity of neural connections underlying oxytocin-mediated parental behaviors of male mice. Inada K, Hagihara M, Tsujimoto K, Abe T, Konno A, Hirai H, Kiyonari H, Miyamichi K. Neuron. 2022 Apr 12. pii: S0896-6273(22)00304-X. doi: 10.1016/j.neuron.2022.03.033. 10.1016/j.neuron.2022.03.033 PubMed 35443152