FLT3-MSCV-IRES-GFP
(Plasmid
#184778)
-
PurposeExpresses wildtype FLT3 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 184778 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneMSCV-IRES-GFP
- Backbone size w/o insert (bp) 6441
- Total vector size (bp) 9423
-
Vector typeMammalian Expression, Retroviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFLT3
-
Alt nameCD135
-
Alt nameFLK2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2982
-
GenBank IDNM_004119.3
- Promoter MSCV
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CCCTTGAACCTCCTCGTTCGACC
- 3′ sequencing primer GCATTCCTTTGGCGAGAG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byFLT3 from pDONR223-FLT3 plasmid (https://www.addgene.org/23895/)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FLT3-MSCV-IRES-GFP was a gift from Timothy Ley (Addgene plasmid # 184778 ; http://n2t.net/addgene:184778 ; RRID:Addgene_184778)