pMA4854
(Plasmid
#184849)
-
PurposeCoexpression of PhiC31o recombinase and EGFP
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 184849 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMA2008
-
Backbone manufacturerAlexeyev lab
- Backbone size w/o insert (bp) 4064
- Total vector size (bp) 7057
-
Modifications to backboneInsertion of EGFP and PhiC31o genes with their regulatory elements
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameEGFP
-
Alt nameGFP
-
SpeciesA. victoria
-
Insert Size (bp)720
- Promoter RSV
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer acatggattggacgaaccac
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namePhiC31o
-
SpeciesStreptomyces phage φC31
-
Insert Size (bp)1815
- Promoter CMV
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer caactccgccccattgacgc
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byAddgene
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMA4854 was a gift from Mikhail Alexeyev (Addgene plasmid # 184849 ; http://n2t.net/addgene:184849 ; RRID:Addgene_184849) -
For your References section:
A Method for In Situ Reverse Genetic Analysis of Proteins Involved mtDNA Replication. Kozhukhar N, Spadafora D, Rodriguez YAR, Alexeyev MF. Cells. 2022 Jul 11;11(14). pii: cells11142168. doi: 10.3390/cells11142168. 10.3390/cells11142168 PubMed 35883613