Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pRDA_526
(Plasmid #184859)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 184859 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pXPR_071
  • Backbone manufacturer
    Arlene Sharpe's Lab
  • Backbone size w/o insert (bp) 7095
  • Total vector size (bp) 7463
  • Modifications to backbone
    (1) Modification of the tracrRNA, (2) modification of the stuffer between BsmBI digest sites, (3) addition of a gRNA capture sequence following the tracrRNA, and (4) replacement of the fluorophore Vex with Thy1.1.
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA cassette
  • gRNA/shRNA sequence
    NA
  • Promoter Human U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer GTGAATAGAGTTAGGCAGGGATATTCACC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRDA_526 was a gift from Arlene Sharpe (Addgene plasmid # 184859 ; http://n2t.net/addgene:184859 ; RRID:Addgene_184859)
  • For your References section:

    Framework for in vivo T cell screens. Milling LE, Markson SC, Tjokrosurjo Q, Derosia NM, Streeter ISL, Hickok GH, Lemmen AM, Nguyen TH, Prathima P, Fithian W, Schwartz MA, Hacohen N, Doench JG, LaFleur MW, Sharpe AH. J Exp Med. 2024 Apr 1;221(4):e20230699. doi: 10.1084/jem.20230699. Epub 2024 Feb 27. 10.1084/jem.20230699 PubMed 38411617
Commonly requested with: