T10-T7-hMOV10
(Plasmid
#185052)
-
Purposeexpression of WT human MOV10
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 185052 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCDNA3
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecDNA WT hMOV10
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3012
-
Entrez GeneMOV10 (a.k.a. fSAP113, gb110)
-
Tag
/ Fusion Protein
- T7 (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamH1 (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
T10-T7-hMOV10 was a gift from Constance Ciaudo (Addgene plasmid # 185052 ; http://n2t.net/addgene:185052 ; RRID:Addgene_185052) -
For your References section:
Sequestration of LINE-1 in cytosolic aggregates by MOV10 restricts retrotransposition. Arora R, Bodak M, Penouty L, Hackman C, Ciaudo C. EMBO Rep. 2022 Jul 20:e54458. doi: 10.15252/embr.202154458. 10.15252/embr.202154458 PubMed 35856394