Skip to main content

T10-T7-hMOV10
(Plasmid #185052)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 185052 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCDNA3
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    cDNA WT hMOV10
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3012
  • Entrez Gene
    MOV10 (a.k.a. fSAP113, gb110)
  • Tag / Fusion Protein
    • T7 (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamH1 (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    T10-T7-hMOV10 was a gift from Constance Ciaudo (Addgene plasmid # 185052 ; http://n2t.net/addgene:185052 ; RRID:Addgene_185052)
  • For your References section:

    Sequestration of LINE-1 in cytosolic aggregates by MOV10 restricts retrotransposition. Arora R, Bodak M, Penouty L, Hackman C, Ciaudo C. EMBO Rep. 2022 Jul 20:e54458. doi: 10.15252/embr.202154458. 10.15252/embr.202154458 PubMed 35856394