Skip to main content

pOmniBac zz TEV YBBR POT1
(Plasmid #185444)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 185444 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pOmnibac
  • Backbone size w/o insert (bp) 4553
  • Total vector size (bp) 6999
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Gentamicin, 10 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    POT1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1905
  • GenBank ID
    NP_056265.2
  • Entrez Gene
    POT1 (a.k.a. CMM10, CRMCC3, GLM9, HPOT1, PFBMFT8, TPDS3)
  • Tags / Fusion Proteins
    • ZZ (N terminal on insert)
    • YBBR (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GTAGACGCAAATTCCGCGGGGAAG
  • 3′ sequencing primer CCTCTACAAATGTGGTATGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pOmniBac zz TEV YBBR POT1 was a gift from Ahmet Yildiz (Addgene plasmid # 185444 ; http://n2t.net/addgene:185444 ; RRID:Addgene_185444)
  • For your References section:

    Compartmentalization of telomeres through DNA-scaffolded phase separation. Jack A, Kim Y, Strom AR, Lee DSW, Williams B, Schaub JM, Kellogg EH, Finkelstein IJ, Ferro LS, Yildiz A, Brangwynne CP. Dev Cell. 2022 Jan 24;57(2):277-290.e9. doi: 10.1016/j.devcel.2021.12.017. 10.1016/j.devcel.2021.12.017 PubMed 35077681