pOmniBac zz TEV YBBR POT1
(Plasmid
#185444)
-
PurposeExpresses human POT1 with a zz affinity tag, YBBR labeling site, and TEV cleavage site in insect cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 185444 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepOmnibac
- Backbone size w/o insert (bp) 4553
- Total vector size (bp) 6999
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Gentamicin, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePOT1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1905
-
GenBank IDNP_056265.2
-
Entrez GenePOT1 (a.k.a. CMM10, CRMCC3, GLM9, HPOT1, PFBMFT8, TPDS3)
-
Tags
/ Fusion Proteins
- ZZ (N terminal on insert)
- YBBR (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GTAGACGCAAATTCCGCGGGGAAG
- 3′ sequencing primer CCTCTACAAATGTGGTATGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pOmniBac zz TEV YBBR POT1 was a gift from Ahmet Yildiz (Addgene plasmid # 185444 ; http://n2t.net/addgene:185444 ; RRID:Addgene_185444) -
For your References section:
Compartmentalization of telomeres through DNA-scaffolded phase separation. Jack A, Kim Y, Strom AR, Lee DSW, Williams B, Schaub JM, Kellogg EH, Finkelstein IJ, Ferro LS, Yildiz A, Brangwynne CP. Dev Cell. 2022 Jan 24;57(2):277-290.e9. doi: 10.1016/j.devcel.2021.12.017. 10.1016/j.devcel.2021.12.017 PubMed 35077681