pCW57-mcGAS
(Plasmid
#185458)
-
PurposeInducible FLAG-tagged mouse cGAS
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 185458 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCW57-MCS1-P2A-MCS2 (Hygro)
-
Backbone manufacturerAdam Karpf
- Backbone size w/o insert (bp) 8185
- Total vector size (bp) 9805
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namecGAS
-
Alt nameMB21D1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1617
-
GenBank IDNM_173386
-
Tag
/ Fusion Protein
- FLAG (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer CGTATGTCGAGGTAGGCGTG
- 3′ sequencing primer GTGAAGAATGTGCGAGACCCAG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCW57-mcGAS was a gift from Shitao Li (Addgene plasmid # 185458 ; http://n2t.net/addgene:185458 ; RRID:Addgene_185458) -
For your References section:
Nuclear soluble cGAS senses double-stranded DNA virus infection. Wu Y, Song K, Hao W, Li J, Wang L, Li S. Commun Biol. 2022 May 10;5(1):433. doi: 10.1038/s42003-022-03400-1. 10.1038/s42003-022-03400-1 PubMed 35538147