fluoPEER-HEK3_5bp-del
(Plasmid
#185476)
-
PurposeFluorescent reporter for a 5 basepair deletion at the HEK3 locus.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 185476 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepmGFP-P2A-K0-P2A-RFP
-
Backbone manufacturerRamanujan Hegde
- Backbone size w/o insert (bp) 5964
- Total vector size (bp) 5999
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHEK3 editing site
-
SpeciesH. sapiens (human)
-
Insert Size (bp)59
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site Acc65I (not destroyed)
- 5′ sequencing primer atgtggcgattctacacagaag
- 3′ sequencing primer ttggtcaccttcagcttgg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The reporter can be used in combination with pegRNA-HEK3_del1-5-NGG with any type of prime editor, which will also edit the HEK3 locus on the human genome. Editing on the reporter will result in mCherry fluorescence.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
fluoPEER-HEK3_5bp-del was a gift from Sabine Fuchs (Addgene plasmid # 185476 ; http://n2t.net/addgene:185476 ; RRID:Addgene_185476) -
For your References section:
Mutation-specific reporter for optimization and enrichment of prime editing. Schene IF, Joore IP, Baijens JHL, Stevelink R, Kok G, Shehata S, Ilcken EF, Nieuwenhuis ECM, Bolhuis DP, van Rees RCM, Spelier SA, van der Doef HPJ, Beekman JM, Houwen RHJ, Nieuwenhuis EES, Fuchs SA. Nat Commun. 2022 Mar 1;13(1):1028. doi: 10.1038/s41467-022-28656-3. 10.1038/s41467-022-28656-3 PubMed 35232966