Skip to main content
Addgene

fluoPEER-GFP>BFP
(Plasmid #185477)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 185477 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pmGFP-P2A-K0-P2A-RFP
  • Backbone manufacturer
    Ramanujan Hegde
  • Backbone size w/o insert (bp) 5964
  • Total vector size (bp) 5986
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GFP-Y66-editing-site
  • Species
    Synthetic
  • Insert Size (bp)
    46
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site Acc65I (not destroyed)
  • 5′ sequencing primer atgtggcgattctacacagaag
  • 3′ sequencing primer ttggtcaccttcagcttgg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The reporter can be used in combination with pegRNA-GFP>BFP_Y66H-NGG with any type of prime editor. This pegRNA does not edit the human genome, therefore the combination of this reporter and the corresponding pegRNA can be cotransfected with your own pegRNA of interest to enrich for prime edited cells. Editing on the reporter will result in mCherry fluorescence.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    fluoPEER-GFP>BFP was a gift from Sabine Fuchs (Addgene plasmid # 185477 ; http://n2t.net/addgene:185477 ; RRID:Addgene_185477)
  • For your References section:

    Mutation-specific reporter for optimization and enrichment of prime editing. Schene IF, Joore IP, Baijens JHL, Stevelink R, Kok G, Shehata S, Ilcken EF, Nieuwenhuis ECM, Bolhuis DP, van Rees RCM, Spelier SA, van der Doef HPJ, Beekman JM, Houwen RHJ, Nieuwenhuis EES, Fuchs SA. Nat Commun. 2022 Mar 1;13(1):1028. doi: 10.1038/s41467-022-28656-3. 10.1038/s41467-022-28656-3 PubMed 35232966