pHPSE-P6
(Plasmid #185907)

• Purpose: Engineered Human Heparanase mutant for e.coli expression
• Depositing Lab: Colin Jackson
• Publication: Whitefield et al RSC Chem Biol. 2022 Feb 15;3(3):341-349. doi: 10.1039/d1cb00239b. eCollection 2022 Mar 9.

Backbone

• Vector backbone: pETDuet-1
• Backbone manufacturer: Novagen
• Backbone size w/o insert (bp): 5420
• Total vector size (bp): 6737
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: induce with 0.05 mM IPTG at an OD of 0.6-1.5. Spin down after 3 hours post induction
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: HPSE1
• Alt name: HPSE-8 kDa subunit
• Species: H. sapiens (human)
• Insert Size (bp): 207
• GenBank ID:
• Entrez Gene: HPSE (a.k.a. HPA, HPA1, HPR1, HPSE1, HSE1)
• Promoter: T7
• Tag / Fusion Protein:
  • His-tag (N terminal on backbone)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: atgcgtccggcgtaga
• 3′ sequencing primer: gattatgcggccgtgtacaa

Gene/Insert 2

• Gene/Insert name: HPSE1
• Alt name: HPSE-50kDa subunit
• Species: H. sapiens (human), Synthetic
• Insert Size (bp): 1166
• Entrez Gene: HPSE (a.k.a. HPA, HPA1, HPR1, HPSE1, HSE1)
• Promoter: T7

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: ttgtacacggccgcataatc
• 3′ sequencing primer: gctagttattgctcagcgg

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry