pUC18-iSpinach
(Plasmid
#186053)
-
Purposetemplate for co-transcriptional RNA folding assays
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 186053 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepUC18
- Backbone size w/o insert (bp) 2666
- Total vector size (bp) 2863
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameT7A1-rrnG-iSpinach
-
SpeciesSynthetic
-
Insert Size (bp)197
- Promoter T7A1
-
Tag
/ Fusion Protein
- no
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer CATAAGCTTAATTGACTTAAAGTCTAACCT
- 3′ sequencing primer CATGGTACCCGCATAATTTGGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUC18-iSpinach was a gift from Markus Wahl (Addgene plasmid # 186053 ; http://n2t.net/addgene:186053 ; RRID:Addgene_186053) -
For your References section:
Structure-Based Mechanisms of a Molecular RNA Polymerase/Chaperone Machine Required for Ribosome Biosynthesis. Huang YH, Hilal T, Loll B, Burger J, Mielke T, Bottcher C, Said N, Wahl MC. Mol Cell. 2020 Sep 17;79(6):1024-1036.e5. doi: 10.1016/j.molcel.2020.08.010. Epub 2020 Aug 31. 10.1016/j.molcel.2020.08.010 PubMed 32871103