Skip to main content
Addgene

pcI-ts,ind+-(mtSSB delta20)
(Plasmid #186280)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 186280 Standard format: Plasmid sent in bacteria as agar stab 1 $89 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pcI-ts,ind+
  • Backbone size w/o insert (bp) 3400
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Mitochondrial Single Stranded DNA Binding Protein
  • Alt name
    mtSSB
  • Species
    H. sapiens (human)
  • Mutation
    First 20 amino acids corresponding to probable mitochondrial targeting sequence deleted
  • GenBank ID
    M94556.1
  • Entrez Gene
    SSBP1 (a.k.a. Mt-SSB, OPA13, SOSS-B1, SSBP, mtSSB)
  • Promoter lambda

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer AAATTGCTTTAAGGCGACGTGC
  • 3′ sequencing primer GCTTCGCAACGTTCAAATCCGCTCC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Received from Yufeng Qian

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcI-ts,ind+-(mtSSB delta20) was a gift from Kenneth Johnson (Addgene plasmid # 186280 ; http://n2t.net/addgene:186280 ; RRID:Addgene_186280)
  • For your References section:

    The human mitochondrial single-stranded DNA-binding protein displays distinct kinetics and thermodynamics of DNA binding and exchange. Qian Y, Johnson KA. J Biol Chem. 2017 Aug 4;292(31):13068-13084. doi: 10.1074/jbc.M117.791392. Epub 2017 Jun 14. 10.1074/jbc.M117.791392 PubMed 28615444