pcI-ts,ind+-(mtSSB delta20)
(Plasmid
#186280)
-
PurposeExpresses Human Mitochondrial SSB in E. coli
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 186280 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * | |
* Log in to view industry pricing.
Backbone
-
Vector backbonepcI-ts,ind+
- Backbone size w/o insert (bp) 3400
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMitochondrial Single Stranded DNA Binding Protein
-
Alt namemtSSB
-
SpeciesH. sapiens (human)
-
MutationFirst 20 amino acids corresponding to probable mitochondrial targeting sequence deleted
-
GenBank IDM94556.1
-
Entrez GeneSSBP1 (a.k.a. Mt-SSB, OPA13, SOSS-B1, SSBP, mtSSB)
- Promoter lambda
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer AAATTGCTTTAAGGCGACGTGC
- 3′ sequencing primer GCTTCGCAACGTTCAAATCCGCTCC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byReceived from Yufeng Qian
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcI-ts,ind+-(mtSSB delta20) was a gift from Kenneth Johnson (Addgene plasmid # 186280 ; http://n2t.net/addgene:186280 ; RRID:Addgene_186280) -
For your References section:
The human mitochondrial single-stranded DNA-binding protein displays distinct kinetics and thermodynamics of DNA binding and exchange. Qian Y, Johnson KA. J Biol Chem. 2017 Aug 4;292(31):13068-13084. doi: 10.1074/jbc.M117.791392. Epub 2017 Jun 14. 10.1074/jbc.M117.791392 PubMed 28615444