-
PurposeThis plasmid carries the majority suite of Agrobacterium virulence genes from Ti plasmid pTiBo542. The additional copies of vir genes enhance Agrobacterium-mediated plant transformation.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 186332 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepRK2-AraE
-
Backbone manufacturerBrian Pfleger
- Backbone size w/o insert (bp) 3660
- Total vector size (bp) 29605
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Gentamicin, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namevirulence genes from Agrobacterium tumefaciens pTiBo542
-
SpeciesAgrobacterium tumefaciens
-
Insert Size (bp)25945
-
GenBank IDDQ058764.1
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cgttcggtcaaggttctgga
- 3′ sequencing primer aacacgcctgggtcaatgat (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byQi-Jun Chen
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The vir genes were from pVS1-VIR2 (Plasmid #134745).
Zhang Q, Zhang Y, Lu MH, Chai YP, Jiang YY, Zhou Y, Wang XC, Chen QJ. A Novel Ternary Vector System United with Morphogenic Genes Enhances CRISPR/Cas Delivery in Maize. Plant Physiol. 2019 Dec;181(4):1441-1448. doi: 10.1104/pp.19.00767.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKL2299 was a gift from Kan Wang (Addgene plasmid # 186332 ; http://n2t.net/addgene:186332 ; RRID:Addgene_186332) -
For your References section:
An Improved Agrobacterium-Mediated Transformation and Genome-Editing Method for Maize Inbred B104 Using a Ternary Vector System and Immature Embryos. Kang M, Lee K, Finley T, Chappell H, Veena V, Wang K. Front Plant Sci. 2022 May 4;13:860971. doi: 10.3389/fpls.2022.860971. eCollection 2022. 10.3389/fpls.2022.860971 PubMed 35599865