Skip to main content
Addgene

pDGB1alpha11_SulR
(Plasmid #186424)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 186424 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pDB1alpha11:empty
  • Backbone manufacturer
    made by Tomáš Moravec, IEB, Prague, Czech Republic (Addgene #106207)
  • Backbone size w/o insert (bp) 2604
  • Total vector size (bp) 4403
  • Vector type
    Plant Expression, Synthetic Biology ; binary vector for Escherichia coli and Agrobacterium tumefaciens-mediated plant transformation

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SulR
  • Alt name
    sulfadiazine resistance with nopaline synthase promoter/terminator
  • Alt name
    Pnos:sulI:Tnos
  • Species
    A. thaliana (mustard weed), Synthetic
  • Insert Size (bp)
    1799
  • Mutation
    BsaI and BsmBI sites removed
  • Promoter Pnos

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer pDGB1_alpha_F: CAACCTCTCGGGCTTCTGGA
  • 3′ sequencing primer pDGB1_alpha_R: GCGACTTAGTTTACCCGCCAA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDGB1alpha11_SulR was a gift from Lukas Fischer (Addgene plasmid # 186424 ; http://n2t.net/addgene:186424 ; RRID:Addgene_186424)
  • For your References section:

    Sulfadiazine and phosphinothricin selection systems optimised for the transformation of tobacco BY-2 cells. Kobercova E, Srba M, Fischer L. Plant Cell Rep. 2023 Jan 7. doi: 10.1007/s00299-022-02975-7. 10.1007/s00299-022-02975-7 PubMed 36609768