pDGB3omega1_KanR_BastaR
(Plasmid
#186426)
-
Purposeoptimisation of phosphinothricin (Basta) selection in plant cells; combines kanamycin resistance gene (nptII) and Basta resistance gene (bar)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 186426 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepDGB3_omega1 (Plasmid #68238)
-
Backbone manufacturerGoldenBraid 2.0 kit from Diego Orzaez (Addgene kit # 1000000076 ), IBMCP, Valencia, Spain
- Backbone size w/o insert (bp) 6702
- Total vector size (bp) 10121
-
Vector typePlant Expression, Synthetic Biology ; binary vector for Escherichia coli and Agrobacterium tumefaciens-mediated plant transformation
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameKanR
-
Alt namekanamycin resistance
-
Alt nameneomycin phosphotransferase II with nopaline synthase promoter/terminator
-
Alt namenptII
-
SpeciesA. thaliana (mustard weed), Synthetic
-
Insert Size (bp)1398
-
MutationBsaI and BsmBI sites removed
- Promoter Pnos
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer pDGB3_omega_F: GGTGGCAGGATATATTGTGG
- 3′ sequencing primer pDGB3_omega_R: CTTAGGTTTACCCGCCAATA
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameBastaR
-
Alt namebar gene for plant expression
-
Alt namephosphinothricin (bialaphos) resistance
-
Alt namephosphinothricin N-acetyltransferase
-
SpeciesA. thaliana (mustard weed), Synthetic
-
Insert Size (bp)2021
-
MutationBsaI and BsmBI sites removed
- Promoter CaMV 35S
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer pDGB3_omega_F: GGTGGCAGGATATATTGTGG
- 3′ sequencing primer pDGB3_omega_R: CTTAGGTTTACCCGCCAATA
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bywe combined pEGB Tnos:NptII:Pnos (#68212, Addgene) and pDGB1alpha2_BastaR, which was prepared by Tomáš Moravec, IEB, Prague, Czech Republic
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDGB3omega1_KanR_BastaR was a gift from Lukas Fischer (Addgene plasmid # 186426 ; http://n2t.net/addgene:186426 ; RRID:Addgene_186426) -
For your References section:
Sulfadiazine and phosphinothricin selection systems optimised for the transformation of tobacco BY-2 cells. Kobercova E, Srba M, Fischer L. Plant Cell Rep. 2023 Jan 7. doi: 10.1007/s00299-022-02975-7. 10.1007/s00299-022-02975-7 PubMed 36609768