pDGB3omega1_KanR_BastaR
(Plasmid #186426)

• Purpose: optimisation of phosphinothricin (Basta) selection in plant cells; combines kanamycin resistance gene (nptII) and Basta resistance gene (bar)
• Depositing Lab: Lukas Fischer
• Publication: Kobercova et al Plant Cell Rep. 2023 Jan 7. doi: 10.1007/s00299-022-02975-7.

Backbone

• Vector backbone: pDGB3_omega1 (Plasmid #68238)
• Backbone manufacturer: GoldenBraid 2.0 kit from Diego Orzaez (Addgene kit # 1000000076 ), IBMCP, Valencia, Spain
• Backbone size w/o insert (bp): 6702
• Total vector size (bp): 10121
• Vector type: Plant Expression, Synthetic Biology ; binary vector for Escherichia coli and Agrobacterium tumefaciens-mediated plant transformation

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: KanR
• Alt name: kanamycin resistance
• Alt name: neomycin phosphotransferase II with nopaline synthase promoter/terminator
• Alt name: nptII
• Species: A. thaliana (mustard weed), Synthetic
• Insert Size (bp): 1398
• Mutation: BsaI and BsmBI sites removed
• Promoter: Pnos

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsmBI (destroyed during cloning)
• 3′ cloning site: BsmBI (destroyed during cloning)
• 5′ sequencing primer: pDGB3_omega_F: GGTGGCAGGATATATTGTGG
• 3′ sequencing primer: pDGB3_omega_R: CTTAGGTTTACCCGCCAATA

Gene/Insert 2

• Gene/Insert name: BastaR
• Alt name: bar gene for plant expression
• Alt name: phosphinothricin (bialaphos) resistance
• Alt name: phosphinothricin N-acetyltransferase
• Species: A. thaliana (mustard weed), Synthetic
• Insert Size (bp): 2021
• Mutation: BsaI and BsmBI sites removed
• Promoter: CaMV 35S

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsmBI (destroyed during cloning)
• 3′ cloning site: BsmBI (destroyed during cloning)
• 5′ sequencing primer: pDGB3_omega_F: GGTGGCAGGATATATTGTGG
• 3′ sequencing primer: pDGB3_omega_R: CTTAGGTTTACCCGCCAATA

Resource Information

• Supplemental Documents:
  • pDGB3omega1_KanR_BastaR.gb
• A portion of this plasmid was derived from a plasmid made by: we combined pEGB Tnos:NptII:Pnos (#68212, Addgene) and pDGB1alpha2_BastaR, which was prepared by Tomáš Moravec, IEB, Prague, Czech Republic

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry