pDGB1alpha11_SulR
(Plasmid #186424)

• Purpose: transcriptional unit for sulfadiazine resistance; plant expression driven by the Pnos promoter; suitable for quintuple assembly
• Depositing Lab: Lukas Fischer
• Publication: Kobercova et al Plant Cell Rep. 2023 Jan 7. doi: 10.1007/s00299-022-02975-7.

Backbone

• Vector backbone: pDB1alpha11:empty
• Backbone manufacturer: made by Tomáš Moravec, IEB, Prague, Czech Republic (Addgene #106207)
• Backbone size w/o insert (bp): 2604
• Total vector size (bp): 4403
• Vector type: Plant Expression, Synthetic Biology ; binary vector for Escherichia coli and Agrobacterium tumefaciens-mediated plant transformation

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: SulR
• Alt name: sulfadiazine resistance with nopaline synthase promoter/terminator
• Alt name: Pnos:sulI:Tnos
• Species: A. thaliana (mustard weed), Synthetic
• Insert Size (bp): 1799
• Mutation: BsaI and BsmBI sites removed
• Promoter: Pnos

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsaI (destroyed during cloning)
• 3′ cloning site: BsaI (destroyed during cloning)
• 5′ sequencing primer: pDGB1_alpha_F: CAACCTCTCGGGCTTCTGGA
• 3′ sequencing primer: pDGB1_alpha_R: GCGACTTAGTTTACCCGCCAA

Resource Information

• Supplemental Documents:
  • pDGB1alpha11_SulR.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry