pTarget
(Plasmid
#186452)
-
Purpose(Empty Backbone) used as source for acquisition of new spacers
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 186452 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET LIC (2A-T)
-
Modifications to backboneIncluded sequences from puc19 plasmid
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GAGATTAGCCTTGATGAATTTAAGTTCATG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTarget was a gift from John van der Oost (Addgene plasmid # 186452 ; http://n2t.net/addgene:186452 ; RRID:Addgene_186452) -
For your References section:
Adaptation by Type V-A and V-B CRISPR-Cas Systems Demonstrates Conserved Protospacer Selection Mechanisms Between Diverse CRISPR-Cas Types. Wu WY, Jackson SA, Almendros C, Haagsma AC, Yilmaz S, Gort G, van der Oost J, Brouns SJJ, Staals RHJ. CRISPR J. 2022 Aug;5(4):536-547. doi: 10.1089/crispr.2021.0150. Epub 2022 Jul 12. 10.1089/crispr.2021.0150 PubMed 35833800