ER2-mGreenLantern
(Plasmid
#186548)
-
PurposeLocalization and retention of mGreenLantern fluorescent protein in the ER; improved targeting efficiency
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 186548 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA3.1
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemGreenLantern
-
Alt namemGL
-
SpeciesSynthetic
-
Insert Size (bp)717
-
MutationClover-F64L/S72A/E124V/N149K/I167T/S175G/A206K/L221K/F223R/G232D
- Promoter CMV
-
Tags
/ Fusion Proteins
- Calreticulin (N terminal on insert)
- KDEL (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer CMV Forward (CGCAAATGGGCGGTAGGCGTG)
- 3′ sequencing primer BGH Reverse (TAGAAGGCACAGTCGAGG) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
To improve ER localization compared to Addgene #164463, the Kozak sequence and ATG that were N-terminal to the FP have been deleted.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ER2-mGreenLantern was a gift from Gregory Petsko (Addgene plasmid # 186548 ; http://n2t.net/addgene:186548 ; RRID:Addgene_186548) -
For your References section:
Chemically stable fluorescent proteins for advanced microscopy. Campbell BC, Paez-Segala MG, Looger LL, Petsko GA, Liu CF. Nat Methods. 2022 Nov 7. pii: 10.1038/s41592-022-01660-7. doi: 10.1038/s41592-022-01660-7. 10.1038/s41592-022-01660-7 PubMed 36344833