Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pLV-mNeon-TurboID
(Plasmid #186610)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 186610 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLV-eGFP_Addgene#36083
  • Total vector size (bp) 8452
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    mNeon-V5-TurboID
  • Species
    E. coli
  • Insert Size (bp)
    1737
  • Mutation
    For reference see Branon et al., 2018
  • Promoter CMV
  • Tag / Fusion Protein
    • mNeonGreen (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site BsrGI (not destroyed)
  • 5′ sequencing primer GGTCTATATAAGCAGAGCTCGTTTAGTG
  • 3′ sequencing primer GCAGCGTATCCACATAGCGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLV-mNeon-TurboID was a gift from Gia Voeltz (Addgene plasmid # 186610 ; http://n2t.net/addgene:186610 ; RRID:Addgene_186610)
  • For your References section:

    The ER ladder is a unique morphological feature of developing mammalian axons. Zamponi E, Meehl JB, Voeltz GK. Dev Cell. 2022 Jun 6;57(11):1369-1382.e6. doi: 10.1016/j.devcel.2022.05.002. Epub 2022 May 23. 10.1016/j.devcel.2022.05.002 PubMed 35609616