TagBFP_A1aY1
(Plasmid #158752)

• Purpose: Lentiviral vector for expression of TagBFP_A1aY1 in mammalian cells for detection of tyrosinated microtubules.
• Depositing Lab: Minhajuddin Sirajuddin
• Publication: Kesarwani et al J Cell Biol. 2020 Oct 5;219(10). pii: 152071. doi: 10.1083/jcb.201912107.

Backbone

• Vector backbone: pTRIP-CAG vector
• Backbone manufacturer: Original pTRIP vector from Nicolas Manel
• Backbone size w/o insert (bp): 11595
• Total vector size (bp): 11787
• Modifications to backbone: pTRIP-CAG vector cloned with TagBFP_A1aY1 in between NheI and BamHI restriction sites.
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: TagBFP-T_A1aY1
• Alt name: Blue tyrosination sensor
• Alt name: Blue A1aY1 sensor
• Insert Size (bp): 192
• Promoter: CAG (CMV enhancer and chicken beta actin promoter)
• Tag / Fusion Protein:
  • TagBFP (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GAGCCTCTGCTAACCATGTTC
• 3′ sequencing primer: CACAATCAGCATTGGTAGCTGC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Obtained the pTRIP-CAG plasmid from Dr Carsten Janke's lab with permission obtained from Dr Nicolas Manel at Institut Curie, Paris Cedex, France.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry