pMCSG53-DsbC
(Plasmid
#186623)
-
Purpose(Empty Backbone) E. coli expression vector containing N-terminal leaderless DsbC-6His-TEV fusion.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 186623 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMCSG53
-
Backbone manufacturerEschenfeldt, W. H., Makowska-Grzyska, M., Stols, L., Donnelly, M. I., Jedrzejczak, R., & Joachimiak, A.
- Backbone size (bp) 5834
-
Modifications to backboneA leaderless DsbC protein has been added in-frame upstream of a 6His-TEV site. Facilitates cytosolic expression of disulfide-rich proteins in E.coli including many families of growth factors.
-
Vector typeBacterial Expression
- Promoter T7
-
Tag
/ Fusion Protein
- DsbC-6His-TEV (N terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberHigh Copy
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Read the preprint on bioRxiv: https://www.biorxiv.org/content/10.1101/2022.02.15.480596v1.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMCSG53-DsbC was a gift from Alexei Savchenko (Addgene plasmid # 186623 ; http://n2t.net/addgene:186623 ; RRID:Addgene_186623) -
For your References section:
Recombinant production of growth factors for application in cell culture. Venkatesan M, Semper C, Skrivergaard S, Di Leo R, Mesa N, Rasmussen MK, Young JF, Therkildsen M, Stogios PJ, Savchenko A. iScience. 2022 Sep 3;25(10):105054. doi: 10.1016/j.isci.2022.105054. eCollection 2022 Oct 21. 10.1016/j.isci.2022.105054 PubMed 36157583