Skip to main content

Cas9_YTHDF2_sgRNA
(Plasmid #186673)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 186673 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pL-CRISPR.EFS.GFP
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    YTHDF2 KO sgRNA Plasmid
  • gRNA/shRNA sequence
    GACGAGGCCCGCCGAGAGAA
  • Species
    H. sapiens (human)
  • Entrez Gene
    YTHDF2 (a.k.a. CAHL, DF2, HGRG8, NY-REN-2)

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

sgRNA sequence: GAACGCGGCAGACGCGCCAC. The corresponding genome sequence is: AAACGCGGCAGACGCGCCAC.

Please visit https://www.biorxiv.org/content/10.1101/2020.12.18.423517v1 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Cas9_YTHDF2_sgRNA was a gift from Astrid Haase (Addgene plasmid # 186673 ; http://n2t.net/addgene:186673 ; RRID:Addgene_186673)
  • For your References section:

    Functional editing of endogenous genes through rapid selection of cell pools (Rapid generation of endogenously tagged genes in Drosophila ovarian somatic sheath cells). Meng Q, Stoyko D, Andrews CM, Konstantinidou P, Genzor P, O T, Elchert AR, Benner L, Sobti S, Katz EY, Haase AD. Nucleic Acids Res. 2022 May 27. pii: 6594084. doi: 10.1093/nar/gkac448. 10.1093/nar/gkac448 PubMed 35639929