Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAAV-CNTF
(Plasmid #195338)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 195338 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV-MCS
  • Backbone manufacturer
    Stratagene
  • Backbone size w/o insert (bp) 4650
  • Total vector size (bp) 6027
  • Modifications to backbone
    B J Yungher, X Luo, Y Salgueiro, M G Blackmore, K K Park (2015) Viral vector-based improvement of optic nerve regeneration: characterization of individual axons' growth patterns and synaptogenesis in a visual target.
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Ciliary neurotrophic factor
  • Alt name
    CNTF
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    651
  • GenBank ID
    NM_000614.4
  • Entrez Gene
    CNTF (a.k.a. HCNTF)
  • Promoter UbC promoter with beta-globin intron
  • Tag / Fusion Protein
    • NGF signal peptide (N terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer caacctggactctgcggatg
  • 3′ sequencing primer catcccatccgcagagtcc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-CNTF was a gift from Kevin Park (Addgene plasmid # 195338 ; http://n2t.net/addgene:195338 ; RRID:Addgene_195338)
  • For your References section:

    Viral vector-based improvement of optic nerve regeneration: characterization of individual axons' growth patterns and synaptogenesis in a visual target. Yungher BJ, Luo X, Salgueiro Y, Blackmore MG, Park KK. Gene Ther. 2015 Oct;22(10):811-21. doi: 10.1038/gt.2015.51. Epub 2015 May 25. 10.1038/gt.2015.51 PubMed 26005861