pLenti_rtTA-P2A-BFP_HygroR
(Plasmid
#186738)
-
PurposertTA-P2A-BFP expression construct cloned into lentiviral backbone
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 186738 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonelentiGuide-Puro (Plasmid #52963)
- Backbone size w/o insert (bp) 10183
- Total vector size (bp) 11363
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namertTA
- Promoter EF1a
-
Tag
/ Fusion Protein
- P2A-BFP
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ataagtgcagtagtcgccgt
- 3′ sequencing primer ctggagacgtggaggagaacc
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti_rtTA-P2A-BFP_HygroR was a gift from Richard Sherwood (Addgene plasmid # 186738 ; http://n2t.net/addgene:186738 ; RRID:Addgene_186738) -
For your References section:
Systematic elucidation of genetic mechanisms underlying cholesterol uptake. Hamilton MC, Fife JD, Akinci E, Yu T, Khowpinitchai B, Cha M, Barkal S, Thi TT, Yeo GHT, Barroso JPR, Francoeur MJ, Velimirovic M, Gifford DK, Lettre G, Yu H, Cassa CA, Sherwood RI. bioRxiv. 2023 Jan 10:2023.01.09.500804. doi: 10.1101/2023.01.09.500804. Preprint. 10.1101/2023.01.09.500804 PubMed 36711952