Skip to main content

pLenti_rtTA-P2A-BFP_HygroR
(Plasmid #186738)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 186738 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    lentiGuide-Puro (Plasmid #52963)
  • Backbone size w/o insert (bp) 10183
  • Total vector size (bp) 11363
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    rtTA
  • Promoter EF1a
  • Tag / Fusion Protein
    • P2A-BFP

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ataagtgcagtagtcgccgt
  • 3′ sequencing primer ctggagacgtggaggagaacc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti_rtTA-P2A-BFP_HygroR was a gift from Richard Sherwood (Addgene plasmid # 186738 ; http://n2t.net/addgene:186738 ; RRID:Addgene_186738)
  • For your References section:

    Systematic elucidation of genetic mechanisms underlying cholesterol uptake. Hamilton MC, Fife JD, Akinci E, Yu T, Khowpinitchai B, Cha M, Barkal S, Thi TT, Yeo GHT, Barroso JPR, Francoeur MJ, Velimirovic M, Gifford DK, Lettre G, Yu H, Cassa CA, Sherwood RI. bioRxiv. 2023 Jan 10:2023.01.09.500804. doi: 10.1101/2023.01.09.500804. Preprint. 10.1101/2023.01.09.500804 PubMed 36711952