Skip to main content

REEP5-mEmerald
(Plasmid #186964)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 186964 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone size w/o insert (bp) 5345
  • Total vector size (bp) 6632
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Reep5
  • Alt name
    Dp1; R74856; DP1/TB2; TB2/DP1; AI324241; AU022809; AW495741
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    567
  • GenBank ID
  • Entrez Gene
    Reep5 (a.k.a. AI324241, AU022809, AW495741, DP1/TB2, Dp1, R74856, TB2/DP1)
  • Promoter CMV Promoter
  • Tag / Fusion Protein
    • mEmerald (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer cgcaaatgggcggtaggcgtg
  • 3′ sequencing primer tagaaggcacagtcgagg
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    HA-REEP5(mouse) was gift from Prof. Tom Rapoport

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    REEP5-mEmerald was a gift from Ke Xu (Addgene plasmid # 186964 ; http://n2t.net/addgene:186964 ; RRID:Addgene_186964)
  • For your References section:

    The endoplasmic reticulum adopts two distinct tubule forms. Wang B, Zhao Z, Xiong M, Yan R, Xu K. Proc Natl Acad Sci U S A. 2022 May 3;119(18):e2117559119. doi: 10.1073/pnas.2117559119. Epub 2022 Apr 26. 10.1073/pnas.2117559119 PubMed 35471903