REEP5-mEmerald
(Plasmid
#186964)
-
PurposeExpress REEP5/DP1 with C-terminus mEmerald
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 186964 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1
- Backbone size w/o insert (bp) 5345
- Total vector size (bp) 6632
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameReep5
-
Alt nameDp1; R74856; DP1/TB2; TB2/DP1; AI324241; AU022809; AW495741
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)567
-
GenBank ID
-
Entrez GeneReep5 (a.k.a. AI324241, AU022809, AW495741, DP1/TB2, Dp1, R74856, TB2/DP1)
- Promoter CMV Promoter
-
Tag
/ Fusion Protein
- mEmerald (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cgcaaatgggcggtaggcgtg
- 3′ sequencing primer tagaaggcacagtcgagg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byHA-REEP5(mouse) was gift from Prof. Tom Rapoport
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
REEP5-mEmerald was a gift from Ke Xu (Addgene plasmid # 186964 ; http://n2t.net/addgene:186964 ; RRID:Addgene_186964) -
For your References section:
The endoplasmic reticulum adopts two distinct tubule forms. Wang B, Zhao Z, Xiong M, Yan R, Xu K. Proc Natl Acad Sci U S A. 2022 May 3;119(18):e2117559119. doi: 10.1073/pnas.2117559119. Epub 2022 Apr 26. 10.1073/pnas.2117559119 PubMed 35471903