AAV_Syn_Xph20_eGFP_CCR5TC
(Plasmid
#187444)
-
PurposeEncodes a specific PSD-95 binder (Xph20) fused to eGFP, CCR5 left-handed zinc finger, and KRAB(A) transcriptional repressor domain
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 187444 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backboneAAV2
- Total vector size (bp) 5744
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameXph20
-
SpeciesSynthetic
-
Insert Size (bp)328
- Promoter Synapsin
-
Tag
/ Fusion Protein
- eGFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site SphI (not destroyed)
- 5′ sequencing primer gatgctagcgccgccaccatggcggg
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byA portion of this plasmid was derived from a plasmid made by Xue Han (Addgene plasmid # 125693 ; http://n2t.net/addgene:125693 ; RRID:Addgene_125693).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2021.04.07.438431 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV_Syn_Xph20_eGFP_CCR5TC was a gift from Matthieu Sainlos (Addgene plasmid # 187444 ; http://n2t.net/addgene:187444 ; RRID:Addgene_187444) -
For your References section:
Engineering paralog-specific PSD-95 recombinant binders as minimally interfering multimodal probes for advanced imaging techniques. Rimbault C, Breillat C, Compans B, Toulme E, Nunes Vicente F, Fernandez-Monreal M, Mascalchi P, Genuer C, Puente-Munoz V, Gauthereau I, Hosy E, Claverol S, Giannone G, Chamma I, Mackereth CD, Poujol C, Choquet D, Sainlos M. Elife. 2024 Jan 3;13:e69620. doi: 10.7554/eLife.69620. 10.7554/eLife.69620 PubMed 38167295