pAAV-syn-SnFR-gamma2-minWPRE
(Plasmid #165497)

• Purpose: AAV for glutamate reporter fused to TARP gamma-2 for postsynaptic localisation
• Depositing Lab: Andrew Plested
• Publication: Hao et al Elife. 2023 Jan 9;12:e84029. doi: 10.7554/eLife.84029.

Backbone

• Vector backbone: pAAV
• Backbone size w/o insert (bp): 4753
• Total vector size (bp): 6830
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: iGluSnFR extracellular domain fused to Stargazin (gamma-2) via NETO2 TM domain
• Alt name: cacng2
• Species: R. norvegicus (rat), Synthetic
• Insert Size (bp): 2877
• Entrez Gene: Cacng2 (a.k.a. Ipr328)
• Promoter: human Synapsin

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: AGTGGGTTTTAGGACCAGG
• 3′ sequencing primer: ccacatagcgtaaaaggagca

Resource Information

• Supplemental Documents:
  • pAAV-syn-SnFR-gamma2-minWPRE.gbk
• A portion of this plasmid was derived from a plasmid made by: Susumu Tomita, Roger Nicoll, Lorin Looger

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Chimera of iGluSnFR (Addgene plasmid # 41732), Neto2 and Gamma-2
pAAV backbone is based on Addgene #61463

Please visit https://doi.org/10.1101/2021.01.21.427382 for bioRxiv preprint.