Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAAV_hSyn1_AchLightG
(Plasmid #187464)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 187464 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV.hSynapsin1
  • Backbone manufacturer
    Viral Vector Facility - University of Zurich
  • Backbone size w/o insert (bp) 4441
  • Total vector size (bp) 6391
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    AchLightG
  • Species
    Synthetic
  • Insert Size (bp)
    1950
  • GenBank ID
  • Promoter human Synapsin-1
  • Tag / Fusion Protein
    • Igκ leader (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer gtaagtatcaaggttacaagacaggttt
  • 3′ sequencing primer gcatgatacaaaggcattaaagcagc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV_hSyn1_AchLightG was a gift from Tommaso Patriarchi (Addgene plasmid # 187464 ; http://n2t.net/addgene:187464 ; RRID:Addgene_187464)
  • For your References section:

    Sensitive multicolor indicators for monitoring norepinephrine in vivo. Kagiampaki Z, Rohner V, Kiss C, Curreli S, Dieter A, Wilhelm M, Harada M, Duss SN, Dernic J, Bhat MA, Zhou X, Ravotto L, Ziebarth T, Wasielewski LM, Sonmez L, Benke D, Weber B, Bohacek J, Reiner A, Wiegert JS, Fellin T, Patriarchi T. Nat Methods. 2023 Sep;20(9):1426-1436. doi: 10.1038/s41592-023-01959-z. 10.1038/s41592-023-01959-z PubMed 37474807