pHis-TEV-Nsp15
(Plasmid
#187656)
-
PurposeE. coli plasmid (T7lac promoter) for full-length, wild-type SARS CoV-2 Nsp15 (uridine-specific nidoviral endoribonuclease, expression-optimized gene) with N-terminal TEV protease cleavable His6-tag
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 187656 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET-11b
-
Backbone manufacturerpurchased from GenScript
- Backbone size w/o insert (bp) 5644
- Total vector size (bp) 6760
-
Modifications to backboneNone. GenScript cloned the expression-optimized insert into NdeI and BamHI sites of pET-11b.
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameNsp15
-
Alt nameNendoU
-
Alt namenon-structural protein 15
-
Alt nameuridylate-specific endoribonuclease
-
SpeciesSevere acute respiratory syndrome coronavirus 2
-
Insert Size (bp)1037
-
Mutationnone
-
Entrez GeneN (a.k.a. GU280_gp10)
- Promoter T7lac
-
Tag
/ Fusion Protein
- TEV protease cleavable His6-tag (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer T7, TAATACGACTCACTATAGGG
- 3′ sequencing primer T7 term, GCTAGTTATTGCTCAGCGG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byPurchased from GenScript the expression-optimized insert in the pET-11b backbone
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Protein sequence is MHHHHHHSSGVDLGTENLYFQSNAM + Nsp15 (amino acid residues 6453-6798 of YP_009724389).
Used for the determination of the atomic-resolution (2.6 angstrom) structure of the room temperature form of SARS-CoV-2 NendoU by serial femtosecond crystallography at an X-ray free-electron laser (XFEL), Protein Data Bank accession number 7K9P, Jernigan et al 2023 Structure 31:1-14, https://doi.org/10.1016/j.str.2022.12.009, PMID 36630960.
Confers ampicillin-resistance.
Backbone vector is pET-11b from GenScript.
Construct design by Debra T. Hansen.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHis-TEV-Nsp15 was a gift from Debra Hansen (Addgene plasmid # 187656 ; http://n2t.net/addgene:187656 ; RRID:Addgene_187656) -
For your References section:
Room-temperature structural studies of SARS-CoV-2 protein NendoU with an X-ray free-electron laser. Jernigan RJ, Logeswaran D, Doppler D, Nagaratnam N, Sonker M, Yang JH, Ketawala G, Martin-Garcia JM, Shelby ML, Grant TD, Mariani V, Tolstikova A, Sheikh MZ, Yung MC, Coleman MA, Zaare S, Kaschner EK, Rabbani MT, Nazari R, Zacks MA, Hayes B, Sierra RG, Hunter MS, Lisova S, Batyuk A, Kupitz C, Boutet S, Hansen DT, Kirian RA, Schmidt M, Fromme R, Frank M, Ros A, Chen JJ, Botha S, Fromme P. Structure. 2022 Dec 30:S0969-2126(22)00495-6. doi: 10.1016/j.str.2022.12.009. 10.1016/j.str.2022.12.009 PubMed 36630960