pHis-TEV-Nsp15
(Plasmid #187656)

• Purpose: E. coli plasmid (T7lac promoter) for full-length, wild-type SARS CoV-2 Nsp15 (uridine-specific nidoviral endoribonuclease, expression-optimized gene) with N-terminal TEV protease cleavable His6-tag
• Depositing Lab: Debra Hansen
• Publication: Jernigan et al Structure. 2022 Dec 30:S0969-2126(22)00495-6. doi: 10.1016/j.str.2022.12.009.

Backbone

• Vector backbone: pET-11b
• Backbone manufacturer: purchased from GenScript
• Backbone size w/o insert (bp): 5644
• Total vector size (bp): 6760
• Modifications to backbone: None. GenScript cloned the expression-optimized insert into NdeI and BamHI sites of pET-11b.
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Nsp15
• Alt name: NendoU
• Alt name: non-structural protein 15
• Alt name: uridylate-specific endoribonuclease
• Species: Severe acute respiratory syndrome coronavirus 2
• Insert Size (bp): 1037
• Mutation: none
• Entrez Gene: N (a.k.a. GU280_gp10)
• Promoter: T7lac
• Tag / Fusion Protein:
  • TEV protease cleavable His6-tag (N terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: T7, TAATACGACTCACTATAGGG
• 3′ sequencing primer: T7 term, GCTAGTTATTGCTCAGCGG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Purchased from GenScript the expression-optimized insert in the pET-11b backbone

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Protein sequence is MHHHHHHSSGVDLGTENLYFQSNAM + Nsp15 (amino acid residues 6453-6798 of YP_009724389).
Used for the determination of the atomic-resolution (2.6 angstrom) structure of the room temperature form of SARS-CoV-2 NendoU by serial femtosecond crystallography at an X-ray free-electron laser (XFEL), Protein Data Bank accession number 7K9P, Jernigan et al 2023 Structure 31:1-14, https://doi.org/10.1016/j.str.2022.12.009, PMID 36630960.
Confers ampicillin-resistance.
Backbone vector is pET-11b from GenScript.
Construct design by Debra T. Hansen.