pETDuet-1_6xHis-TEV-mCh-NDP52
(Plasmid
#187829)
-
PurposePlasmid for the expression and purification of 6xHis-TEV-mCh-NDP52 in E. coli Rosetta pLysS. Internal Reference: SMC1148
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 187829 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepET Duet1
-
Backbone manufacturerSigma-Aldrich
- Backbone size w/o insert (bp) 5420
- Total vector size (bp) 7496
-
Modifications to backboneInsertion of 6His-TEV-mCH-NDP52
-
Vector typeMammalian Expression, Bacterial Expression, Insect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameNDP52
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2142
-
GenBank ID10241 NM_005831
-
Entrez GeneCALCOCO2 (a.k.a. NDP52)
-
Tags
/ Fusion Proteins
- mCherry (N terminal on insert)
- TEV (N terminal on insert)
- 6xHisTag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CACCATCGTGGAACAGTACG
- 3′ sequencing primer gattatgcggccgtgtac (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Manufactured during the Master's thesis of Daniel Bernklau
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pETDuet-1_6xHis-TEV-mCh-NDP52 was a gift from Sascha Martens (Addgene plasmid # 187829 ; http://n2t.net/addgene:187829 ; RRID:Addgene_187829) -
For your References section:
Unconventional initiation of PINK1/Parkin mitophagy by Optineurin. Nguyen TN, Sawa-Makarska J, Khuu G, Lam WK, Adriaenssens E, Fracchiolla D, Shoebridge S, Bernklau D, Padman BS, Skulsuppaisarn M, Lindblom RSJ, Martens S, Lazarou M. Mol Cell. 2023 May 18;83(10):1693-1709.e9. doi: 10.1016/j.molcel.2023.04.021. 10.1016/j.molcel.2023.04.021 PubMed 37207627