pRK172-6xHis-0N4R-P301S-tau-HiBiT
(Plasmid
#187835)
-
PurposeExpression of 6xHis-tagged P301S tau of 0N4R isoform with a C-terminal HiBiT tag for bimolecular luminescence with LgBiT.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 187835 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRK172
- Backbone size w/o insert (bp) 2542
- Total vector size (bp) 3760
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsFor protein production, 16 degrees in DE3 BL21 E coli
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert name6XHis-0N4R-P301S-tau-HiBiT
-
Alt nameTau-HiBiT
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1218
- Promoter T7
-
Tags
/ Fusion Proteins
- 6xHistidine (N terminal on insert)
- HiBiT (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer GATCTCGATCCCGCGAAATT
- 3′ sequencing primer CAAGACCCGTTTAGAGGCCC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRK172-6xHis-0N4R-P301S-tau-HiBiT was a gift from William McEwan (Addgene plasmid # 187835 ; http://n2t.net/addgene:187835 ; RRID:Addgene_187835) -
For your References section:
Cholesterol determines the cytosolic entry and seeded aggregation of tau. Tuck BJ, Miller LVC, Katsinelos T, Smith AE, Wilson EL, Keeling S, Cheng S, Vaysburd MJ, Knox C, Tredgett L, Metzakopian E, James LC, McEwan WA. Cell Rep. 2022 May 3;39(5):110776. doi: 10.1016/j.celrep.2022.110776. 10.1016/j.celrep.2022.110776 PubMed 35508140