Skip to main content

pKL123
(Plasmid #187889)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 187889 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUCM
  • Backbone size w/o insert (bp) 8700
  • Total vector size (bp) 11809
  • Vector type
    Mammalian Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NFIA-SOX9
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3100
  • GenBank ID
    ENST0000040349 ENST00000245479
  • Promoter TRE3G

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AflII (not destroyed)
  • 3′ cloning site ClaI (not destroyed)
  • 5′ sequencing primer AGCTCGTTTAGTGAACCGTCAGATC
  • 3′ sequencing primer GAAATTTGTGATGCTATTGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pKL123 was a gift from Martin Kampmann (Addgene plasmid # 187889 ; http://n2t.net/addgene:187889 ; RRID:Addgene_187889)
  • For your References section:

    CRISPRi screens in human iPSC-derived astrocytes elucidate regulators of distinct inflammatory reactive states. Leng K, Rose IVL, Kim H, Xia W, Romero-Fernandez W, Rooney B, Koontz M, Li E, Ao Y, Wang S, Krawczyk M, Tcw J, Goate A, Zhang Y, Ullian EM, Sofroniew MV, Fancy SPJ, Schrag MS, Lippmann ES, Kampmann M. Nat Neurosci. 2022 Nov;25(11):1528-1542. doi: 10.1038/s41593-022-01180-9. Epub 2022 Oct 27. 10.1038/s41593-022-01180-9 PubMed 36303069