pKL123
(Plasmid
#187889)
-
PurposeAAVS1 safe-harbor integration of dox-inducible NFIA-SOX9
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 187889 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUCM
- Backbone size w/o insert (bp) 8700
- Total vector size (bp) 11809
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNFIA-SOX9
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3100
-
GenBank IDENST0000040349 ENST00000245479
- Promoter TRE3G
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AflII (not destroyed)
- 3′ cloning site ClaI (not destroyed)
- 5′ sequencing primer AGCTCGTTTAGTGAACCGTCAGATC
- 3′ sequencing primer GAAATTTGTGATGCTATTGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKL123 was a gift from Martin Kampmann (Addgene plasmid # 187889 ; http://n2t.net/addgene:187889 ; RRID:Addgene_187889) -
For your References section:
CRISPRi screens in human iPSC-derived astrocytes elucidate regulators of distinct inflammatory reactive states. Leng K, Rose IVL, Kim H, Xia W, Romero-Fernandez W, Rooney B, Koontz M, Li E, Ao Y, Wang S, Krawczyk M, Tcw J, Goate A, Zhang Y, Ullian EM, Sofroniew MV, Fancy SPJ, Schrag MS, Lippmann ES, Kampmann M. Nat Neurosci. 2022 Nov;25(11):1528-1542. doi: 10.1038/s41593-022-01180-9. Epub 2022 Oct 27. 10.1038/s41593-022-01180-9 PubMed 36303069