pBM5218
(Plasmid
#18796)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 18796 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepRS316
- Backbone size w/o insert (bp) 4887
-
Vector typeYeast Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTy5-HIS3AI
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)6800
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer catgattacgccaagctcgg
- 3′ sequencing primer gacgttgtaaaacgacggcc (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBM5218 was a gift from Mark Johnston (Addgene plasmid # 18796 ; http://n2t.net/addgene:18796 ; RRID:Addgene_18796) -
For your References section:
'Calling Cards' method for high-throughput identification of targets of yeast DNA-binding proteins. Wang H, Heinz ME, Crosby SD, Johnston M, Mitra RD. Nat Protoc. 2008;3(10):1569-77. doi: 10.1038/nprot.2008.148. 10.1038/nprot.2008.148 PubMed 18802438