Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is open for ordering and depositing; find up-to-date details here. To learn more about how we are supporting COVID-19 research and to find related plasmids, check out our COVID-19 and Coronavirus Plasmids & Resources page.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pTU2-A-RFP (p15A origin)
(Plasmid #74090)


Item Catalog # Description Quantity Price (USD)
Plasmid 74090 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
    p15A origin and chloramphenicol resistance
  • Backbone manufacturer
    Terrence Lai (this study)
  • Backbone size w/o insert (bp) 2024
  • Total vector size (bp) 3286
  • Modifications to backbone
    Modifications between XbaI and PstI from original pSB1C3 plasmid. CAT gene - C435G (nucleotide) - silent mutagenesis to remove BsmBI site
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Growth instructions
    10 ml LB culture - use 2X P1, P2 and N3 buffer for mini-prep purification and concentrate elution fraction (~10-20 ng/ul in 50 ul total volume of water) until 50 ng/ul for Golden Gate
  • Copy number
    Low Copy


  • Gene/Insert name
    Golden Gate destination vector - Level 2, 4 TU's with RFP and p15A origin
  • Species
  • Promoter R0010 Const. Promoter controlling RFP

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (destroyed during cloning)
  • 3′ cloning site SpeI (destroyed during cloning)
  • 5′ sequencing primer CTGACGTCTAAGAAACCATT
  • 3′ sequencing primer AACCGTATTACCGCCTTTGA
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTU2-A-RFP (p15A origin) was a gift from Paul Freemont (Addgene plasmid # 74090 ; ; RRID:Addgene_74090)
  • For your References section:

    EcoFlex: A Multifunctional MoClo Kit for E. coli Synthetic Biology. Moore SJ, Lai HE, Kelwick RJ, Chee SM, Bell DJ, Polizzi KM, Freemont PS. ACS Synth Biol. 2016 May 2. 10.1021/acssynbio.6b00031 PubMed 27096716