Skip to main content
Addgene

pCW57-Cx46-IRES-GCaMP6s
(Plasmid #188238)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 188238 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcW57.1
  • Backbone manufacturer
    Addgene, plasmid 41393
  • Backbone size w/o insert (bp) 7611
  • Total vector size (bp) 9345
  • Modifications to backbone
    1743 bp removed (from 267 to 2009)
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GJA3
  • Alt name
    Cx46
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_021954.4
  • Entrez Gene
    GJA3 (a.k.a. CTRCT14, CX46, CZP3)
  • Promoter Tight TRE promoter
  • Tag / Fusion Protein
    • GCaMp6s (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (unknown if destroyed)
  • 3′ cloning site Mlul (unknown if destroyed)
  • 5′ sequencing primer AGAGCTCGTTTAGTGAACCG
  • 3′ sequencing primer GTTTCCGGGCCCTCACATTGC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    GJA3 was gene-synthesised by Bio-Fab Research, https://www.biofabresearch.com/en/

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCW57-Cx46-IRES-GCaMP6s was a gift from Fabio Mammano (Addgene plasmid # 188238 ; http://n2t.net/addgene:188238 ; RRID:Addgene_188238)
  • For your References section:

    A Quantitative Assay for Ca(2+) Uptake through Normal and Pathological Hemichannels. Nardin C, Tettey-Matey A, Donati V, Marazziti D, Di Pietro C, Peres C, Raspa M, Zonta F, Yang G, Gorelik M, Singh S, Cardarelli L, Sidhu SS, Mammano F. Int J Mol Sci. 2022 Jun 30;23(13). pii: ijms23137337. doi: 10.3390/ijms23137337. 10.3390/ijms23137337 PubMed 35806342