Skip to main content

pCAG-G-Flamp1
(Plasmid #188567)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 188567 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCAG
  • Backbone size w/o insert (bp) 6342
  • Total vector size (bp) 7608
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    G-Flamp1
  • Species
    Synthetic
  • Insert Size (bp)
    1266
  • Promoter CAG
  • Tag / Fusion Protein
    • His tag

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer GCAACGTGCTGGTTATTGTG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-G-Flamp1 was a gift from Jun Chu (Addgene plasmid # 188567 ; http://n2t.net/addgene:188567 ; RRID:Addgene_188567)
  • For your References section:

    A high-performance genetically encoded fluorescent indicator for in vivo cAMP imaging. Wang L, Wu C, Peng W, Zhou Z, Zeng J, Li X, Yang Y, Yu S, Zou Y, Huang M, Liu C, Chen Y, Li Y, Ti P, Liu W, Gao Y, Zheng W, Zhong H, Gao S, Lu Z, Ren PG, Ng HL, He J, Chen S, Xu M, Li Y, Chu J. Nat Commun. 2022 Sep 12;13(1):5363. doi: 10.1038/s41467-022-32994-7. 10.1038/s41467-022-32994-7 PubMed 36097007