Skip to main content

pX330 EGFR-sgRNA
(Plasmid #188633)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 188633 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUC ori vector
  • Total vector size (bp) 8487
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    humanized S. pyogenes Cas9
  • Alt name
    SpCas9
  • Alt name
    hSpCas9
  • Insert Size (bp)
    4272
  • Promoter CBh
  • Tag / Fusion Protein
    • 3xFLAG (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BpiI (destroyed during cloning)
  • 3′ cloning site BpiI (destroyed during cloning)
  • 5′ sequencing primer agggatggttggttggtggg
  • 3′ sequencing primer CCAATCCTCCCCCTTGCTGT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    A portion of this plasmid was derived from a plasmid made by Feng Zhang (Addgene # 42230)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2022.08.13.503850 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX330 EGFR-sgRNA was a gift from Jared Toettcher (Addgene plasmid # 188633 ; http://n2t.net/addgene:188633 ; RRID:Addgene_188633)
  • For your References section:

    pYtags enable spatiotemporal measurements of receptor tyrosine kinase signaling in living cells. Farahani PE, Yang X, Mesev EV, Fomby KA, Brumbaugh-Reed EH, Bashor CJ, Nelson CM, Toettcher JE. Elife. 2023 May 22;12:e82863. doi: 10.7554/eLife.82863. 10.7554/eLife.82863 PubMed 37212240