Skip to main content

Mammalian_SaAID2S
(Plasmid #188652)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 188652 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3.1
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    AID2S-nSaCas9--UGI
  • Species
    Synthetic; Staphylococcus aureus
  • Insert Size (bp)
    5175
  • Mutation
    D10A for SaCas9
  • GenBank ID
  • Promoter EF-1a
  • Tag / Fusion Protein
    • UGI

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
  • 3′ sequencing primer GGGGATCTGTGGTCCTCATA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Sa-sgRNA
  • Species
    Staphylococcus aureus
  • Promoter H1

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ATTTGCATGTCGCTATGTGTTCTG
  • 3′ sequencing primer GGCGGAGCCTATGGAAAAAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Mammalian_SaAID2S was a gift from Keiji Nishida (Addgene plasmid # 188652 ; http://n2t.net/addgene:188652 ; RRID:Addgene_188652)
  • For your References section:

    Cytosine base editing systems with minimized off-target effect and molecular size. Li A, Mitsunobu H, Yoshioka S, Suzuki T, Kondo A, Nishida K. Nat Commun. 2022 Aug 8;13(1):4531. doi: 10.1038/s41467-022-32157-8. 10.1038/s41467-022-32157-8 PubMed 35941130