Mammalian_SaAID2S
(Plasmid
#188652)
-
PurposeExpresses SaAID2S and gRNA in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 188652 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameAID2S-nSaCas9--UGI
-
SpeciesSynthetic; Staphylococcus aureus
-
Insert Size (bp)5175
-
MutationD10A for SaCas9
-
GenBank ID
- Promoter EF-1a
-
Tag
/ Fusion Protein
- UGI
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
- 3′ sequencing primer GGGGATCTGTGGTCCTCATA
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameSa-sgRNA
-
SpeciesStaphylococcus aureus
- Promoter H1
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer ATTTGCATGTCGCTATGTGTTCTG
- 3′ sequencing primer GGCGGAGCCTATGGAAAAAC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Mammalian_SaAID2S was a gift from Keiji Nishida (Addgene plasmid # 188652 ; http://n2t.net/addgene:188652 ; RRID:Addgene_188652) -
For your References section:
Cytosine base editing systems with minimized off-target effect and molecular size. Li A, Mitsunobu H, Yoshioka S, Suzuki T, Kondo A, Nishida K. Nat Commun. 2022 Aug 8;13(1):4531. doi: 10.1038/s41467-022-32157-8. 10.1038/s41467-022-32157-8 PubMed 35941130