Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

ipUSEPR-sg-Hs-CD4
(Plasmid #188691)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 188691 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLenti
  • Vector type
    Lentiviral, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgCD4
  • gRNA/shRNA sequence
    GGTGCAATGTAGGAGTCCAA
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    20
  • Mutation
    WT
  • Entrez Gene
    CD4 (a.k.a. CD4mut, IMD79, Leu-3, OKT4D, T4)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    ipUSEPR-sg-Hs-CD4 was a gift from Lewis Cantley (Addgene plasmid # 188691 ; http://n2t.net/addgene:188691 ; RRID:Addgene_188691)