Skip to main content
Addgene

pLEX_305-N-dTAG-FRA1
(Plasmid #188742)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 188742 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLEX_305-N-dTAG (Plasmid #91797)
  • Backbone manufacturer
    James Bradner, Behnam Nabet
  • Backbone size w/o insert (bp) 7997
  • Total vector size (bp) 8819
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Fosl1
  • Alt name
    Fra1
  • Alt name
    fos-like antigen 1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    822
  • Entrez Gene
    Fosl1 (a.k.a. Fra1, fra-1)
  • Promoter hPGK promoter
  • Tag / Fusion Protein
    • FKBP F36V tag (dTAG) (N terminal on backbone)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer TGTTCCGCATTCTGCAAGCCTC
  • 3′ sequencing primer ACAAAGGCATTAAAGCAGCGTATCC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLEX_305-N-dTAG-FRA1 was a gift from Günter Schneider (Addgene plasmid # 188742 ; http://n2t.net/addgene:188742 ; RRID:Addgene_188742)
  • For your References section:

    AP1/Fra1 confers resistance to MAPK cascade inhibition in pancreatic cancer. Schneeweis C, Diersch S, Hassan Z, Krauss L, Schneider C, Lucarelli D, Falcomata C, Steiger K, Ollinger R, Kramer OH, Arlt A, Grade M, Schmidt-Supprian M, Hessmann E, Wirth M, Rad R, Reichert M, Saur D, Schneider G. Cell Mol Life Sci. 2022 Dec 19;80(1):12. doi: 10.1007/s00018-022-04638-y. 10.1007/s00018-022-04638-y PubMed 36534167