pLEX_305-N-dTAG-FRA1
(Plasmid
#188742)
-
Purposeexpresses murine Fosl1 (Fra1) with N-terminal tag FKBP F36V (dTAG) for the dTAG system
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 188742 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLEX_305-N-dTAG (Plasmid #91797)
-
Backbone manufacturerJames Bradner, Behnam Nabet
- Backbone size w/o insert (bp) 7997
- Total vector size (bp) 8819
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFosl1
-
Alt nameFra1
-
Alt namefos-like antigen 1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)822
-
Entrez GeneFosl1 (a.k.a. Fra1, fra-1)
- Promoter hPGK promoter
-
Tag
/ Fusion Protein
- FKBP F36V tag (dTAG) (N terminal on backbone)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer TGTTCCGCATTCTGCAAGCCTC
- 3′ sequencing primer ACAAAGGCATTAAAGCAGCGTATCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLEX_305-N-dTAG-FRA1 was a gift from Günter Schneider (Addgene plasmid # 188742 ; http://n2t.net/addgene:188742 ; RRID:Addgene_188742) -
For your References section:
AP1/Fra1 confers resistance to MAPK cascade inhibition in pancreatic cancer. Schneeweis C, Diersch S, Hassan Z, Krauss L, Schneider C, Lucarelli D, Falcomata C, Steiger K, Ollinger R, Kramer OH, Arlt A, Grade M, Schmidt-Supprian M, Hessmann E, Wirth M, Rad R, Reichert M, Saur D, Schneider G. Cell Mol Life Sci. 2022 Dec 19;80(1):12. doi: 10.1007/s00018-022-04638-y. 10.1007/s00018-022-04638-y PubMed 36534167