PonA-BI-Gl-WT-18xPP7-WT-24xMS2 (Switch)
(Plasmid
#189793)
-
PurposeExpress wild-type beta-globin genes bi-directionally under ponasteron A inducible promoter in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 189793 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonePonA
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namebeta-globin
-
Alt nameHBB
-
SpeciesH. sapiens (human), M. musculus (mouse)
-
Entrez GeneHbb
- Promoter Ponasterone A inducible
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GAAGAACTCAGACACCATATGCC
- 3′ sequencing primer ATATCGTCGACAAGCTTATCG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PonA-BI-Gl-WT-18xPP7-WT-24xMS2 (Switch) was a gift from Robert Singer (Addgene plasmid # 189793 ; http://n2t.net/addgene:189793 ; RRID:Addgene_189793) -
For your References section:
Cellular variability of nonsense-mediated mRNA decay. Sato H, Singer RH. Nat Commun. 2021 Dec 10;12(1):7203. doi: 10.1038/s41467-021-27423-0. 10.1038/s41467-021-27423-0 PubMed 34893608